rs6789494 chr3:194368529 C>A
- Sequence
gaatttactccagatgttcagtct[C/A]tgcagaatgaaggaagtgccagcc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NALM-6 (adult B acute lymphoblastic leukemia) | 0.29 | 1.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Colon_Sigmoid, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid