rs6790639 chr3:177191620 T>C
- Sequence
taaaaatgggaagtgaacataaga[T/C]aaggctcatagaggaactgaactt
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -2.71 | 1.20 | 2.00 | |||
| monocyte-derived dendritic cells | -0.26 | 1.36 | 1.62 |
Items per page:
1 – 2 of 2