rs679416 chr5:10310685 C>G
- Sequence
tgaatcctgtgcacaggaaaggca[C/G]tgctggtgaagacaggtgagaggc
- ASB in cell types
- keratinocytes breast tumor
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.13 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), hdl cholesterol, infant head circumference, obesity with early age of onset (age >2), total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg