rs6798431 chr3:128584530 C>T
- Sequence
gtagcagactggctcacagcagta[C/T]ccactggggcggagctccagcctg
- ASB in cell types
- glioblastoma cells neural cell adrenal gland ascending aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 3.12 | -1.06 | 1.50 | |||
| neural cell | -1.16 | 2.48 | 1.00 | |||
| adrenal gland | 2.10 | -0.76 | 1.00 | |||
| ascending aorta | 2.38 | n/a | 1.00 | |||
| coronary artery | 2.41 | -2.37 | 1.33 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Testis, Thyroid, Whole_Blood