rs68061490 chr17:4420740 A>C
- Sequence
acccagaaacttttgagagcctac[A/C]ccatgcggggcataggtcatgact
- ASB in cell types
- foreskin keratinocyte erythroid cells neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.76 | n/a | 2.17 | |||
| erythroid cells | n/a | 3.76 | 2.00 | |||
| neutrophils | 2.60 | 0.38 | 1.50 |
Items per page:
1 – 3 of 3