rs6810537 chr4:112322109 C>T
- Sequence
ttggcatcctcattaacacccaga[C/T]tggcttattttatgggccagaagc
- ASB in cell types
- foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.61 | n/a | 1.67 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.58 | 0.62 | 1.00 |
Items per page:
1 – 2 of 2