rs6830291 chr4:184949229 C>T
- Sequence
acccctcaggccacatgtaggtta[C/T]ttgtaagttaaagcttgttttgct
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.42 | -0.71 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), refractive error, sporadic creutzfeldt-jakob disease, years of education