rs6840479 chr4:94354691 A>G
- Sequence
ttgctagggtgatgcttgacaccg[A/G]gaggtacagcaaacaaacacggag
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -1.18 | 2.17 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, birth weight, fasting blood glucose, ldl cholesterol change with statins, obesity with early age of onset (age >2), rheumatoid arthritis, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients, total cholesterol change with statins, triglycerides change with statins