rs684527 chr1:183186347 C>A
- Sequence
gagacagagactgagcggcccggc[C/A]ccgccatgcctgcgctctggctgg
- ASB in cell types
- HCT-116 (colon carcinoma) gastroesophageal sphincter IPSC-derived bipolar neuron bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN TYY1_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.49 | 1.44 | 1.21 | n/a | No Hit | |||
| RAD21_HUMAN | 0.43 | 1.17 | 1.06 | n/a | n/a | |||
| TYY1_HUMAN | -0.50 | 1.87 | 1.50 | n/a | No Hit | |||
| SUH_HUMAN | 1.50 | -2.85 | 1.50 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Stomach, Uterus, Whole_Blood