rs6857312 chr4:147590316 G>A
- Sequence
cgtttaaattatagtgaatttgaa[G/A]ttatttattttcagcaaaagcttt
- ASB in cell types
- heart left ventricle TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | -0.87 | 1.78 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.36 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2