rs6861618 chr5:149579090 C>T
- Sequence
tgccccggggagtgttgacactta[C/T]gtctaaaaccacagaatactcaag
- ASB in cell types
- breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | -0.95 | 1.25 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hip bone mineral density (bmd), microalbuminuria, spine bone mineral density (bmd)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Heart_Left_Ventricle, Liver, Nerve_Tibial, Thyroid