rs6874130 chr5:138283236 G>C
- Sequence
accttctgggctttgagttcaagg[G/C]attagggagaaggccacagagaca
- ASB in cell types
- foreskin keratinocyte HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.71 | n/a | 2.33 | |||
| HMEC (human mammary epithelial cells) | 1.98 | 0.01 | 1.00 |
Items per page:
1 – 2 of 2