rs6915719 chr6:78462896 A>C
- Sequence
tgctgactctaaagaaatgatgca[A/C]tgtttacacatccagtcaagtctt
- ASB in cell types
- breast tumor xenograft
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.14 | -2.26 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, homa-b, homa-ir