rs6941255 chr6:151045854 G>A
- Sequence
caggctgctgatggtattgtggcc[G/A]tgccttcctccacaacccagggaa
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) A549 (lung carcinoma) pulmonary artery endothelial cell
- ASB for transcription factors
- GATA2_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 1.96 | -1.52 | 1.00 | n/a | No Hit | |||
| EP300_HUMAN | 1.32 | -0.19 | 1.22 | n/a | n/a |
Items per page:
1 – 2 of 2