rs6953893 chr7:47763112 A>G
- Sequence
agcctctgtgcctggacctcagct[A/G]taggcctggccccattgtgctctc
- ASB in cell types
- Kelly (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | -0.40 | 1.73 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Minor_Salivary_Gland, Pituitary, Small_Intestine_Terminal_Ileum, Spleen