rs6959777 chr7:96833874 C>T
- Sequence
gtgtttcctgaatcaaagagaata[C/T]ttttggagggggaaaattgttctg
- ASB in cell types
- A-673 clone Asp114 (Ewing sarcoma)
- ASB for transcription factors
- FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | -2.92 | 2.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, diastolic blood pressure (dbp), dna repair capacity in cultured peripheral lymphocytes (bpde-damage host-cell reactivation testing) in lung cancer cases and controls, ldl cholesterol, rheumatoid arthritis, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Breast_Mammary_Tissue, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid