rs6964581 chr7:14691791 G>A
- Sequence
gtctcagatttaaggtggtctctt[G/A]agattaaataaggtgcctctgcca
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.72 | -0.37 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.46 | 0.58 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.54 | n/a | 2.00 |
Items per page:
1 – 3 of 3