rs6985153 chr8:140090643 T>C
- Sequence
gggccaggcccttagcacacttca[T/C]ggctaaccctgaaaatcgccatcc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.04 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), asthma, comorbid depressive syndrome and alcohol dependence, neuroblastoma (brain cancer), urinary albumin-to-creatinine ratio