rs6985285 chr8:140090685 T>C
- Sequence
gccatcccccaccaagtgtaccca[T/C]ccctgctttcagaacaaagtacat
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -0.49 | 1.96 | 2.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, birth weight, cystatin c in serum, fasting blood glucose, triglycerides change with statins