rs698815 chr2:44479835 G>T
- Sequence
ttaagttccattttgtatttgaaa[G/T]tgtgtccccaaacaagtattgaca
- ASB in cell types
- A549 (lung carcinoma) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.78 | 0.75 | 1.13 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, total cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Pituitary, Whole_Blood