rs6991067 chr8:94863448 A>G
- Sequence
atattcttttctctgtaaatgagt[A/G]aatcacttcctcttcctgcttcct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HUVEC-C (HUVEC, umbilical vein endothelial cells) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.09 | 0.98 | 1.38 | n/a | No Hit | |||
| TF65_HUMAN | 0.05 | 1.93 | 2.25 | n/a | No Hit | |||
| ETS1_HUMAN | -1.67 | 2.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood