rs6998793 chr8:37839356 C>T
- Sequence
tcactttgaggggttaaggactcc[C/T]taccctatggcctctgtcacattc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.62 | -1.64 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, cleft lip, with or without cleft palate, in asian ancestry population, hypertension (early onset hypertension), late onset alzheimers disease, ldl cholesterol, obesity with early age of onset (age >2), prop taste detection threshold, triglycerides