rs7007919 chr8:20789864 C>T
- Sequence
cgctgtttccatgtggcccccttg[C/T]ggactgtggtgaccctgtctctct
- ASB in cell types
- bipolar neuron neural progenitors IPSC-derived bipolar neuron GM23338
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.34 | 3.22 | 1.42 | 1.09 | Weak Concordant | |||
| RAD21_HUMAN | 0.08 | 1.51 | 1.40 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, bipolar disorder, normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, type 2 diabetes