rs7009359 chr8:65998276 G>A
- Sequence
gtcggttctcagatctcaaactcc[G/A]tgctgggggaaccactactgtctt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.69 | 0.39 | 1.41 | n/a | No Hit | |||
| STAG1_HUMAN | 1.59 | 0.31 | 1.45 | n/a | n/a |
Items per page:
1 – 2 of 2