rs7010551 chr8:57209772 C>G
- Sequence
ggcatggccacgagtagagaaatc[C/G]aggctacaggcagaagtgggagga
- ASB in cell types
- GM02630 (Fanconi anemi) MCF7 (Invasive ductal breast carcinoma) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 2.15 | -1.86 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.63 | -2.67 | 1.00 | |||
| pancreas | 2.06 | -2.03 | 1.00 |
Items per page:
1 – 3 of 3