rs7010625 chr8:3284807 A>T
- Sequence
caggagaaaagagcttactccatt[A/T]cgaccttttctacctgtgtctgaa
- ASB in cell types
- foreskin keratinocyte GM18526 (B – cells Lymphoblastoid Cell Lines) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.94 | 2.17 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 0.04 | 0.93 | 1.00 | |||
| MDM(monocyte derived macrophages) | 1.49 | 0.17 | 2.00 |
Items per page:
1 – 3 of 3