rs7012303 chr8:58948240 A>G
- Sequence
ggctaagcacctgaagcagatcaa[A/G]tgagggtggggcagggtagcccta
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.97 | -0.47 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, neuroblastoma (brain cancer), parkinsons disease (pd), paternal transmission distortion, rheumatoid arthritis, schizophrenia, transmission distortion, waist hip ratio