rs7022455 chr9:98104590 T>C
- Sequence
caagagaatatcatggtcatgaaa[T/C]aaggaagtacgccatctggtttgg
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.37 | -0.27 | 1.04 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol change with statins, major depressive disorder, mean corpuscular volume (mcv), obesity with early age of onset (age >2), personality disorders (pd) - cluster c, tardive dyskinesia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Thyroid, Whole_Blood