rs7026196 chr9:111875214 G>C
- Sequence
cagggtttgtaggtctctggccta[G/C]agcagtggtaatgaggattgaaga
- ASB in cell types
- primary human epidermal keratinocytes
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.36 | -2.38 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, biploar disorder (bipolar affective disorder with comorbid migraine), hdl cholesterol, infant head circumference
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood