rs7028341 chr9:99515286 A>G
- Sequence
ccccaggagtctagggctgagatc[A/G]ggaacacatgacgctgagctgccc
- ASB in cell types
- macrophages form periferal blood GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.46 | 0.42 | 1.92 | n/a | No Hit |
Items per page:
1 – 1 of 1