rs7033145 chr9:3732530 C>G
- Sequence
aattcttcagtgttccatgaataa[C/G]actgttcgggtctaagaggtcaca
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.62 | 1.61 | 1.00 | |||
| SK-N-SH (neuroblastoma) | 2.21 | -1.68 | 1.00 |
Items per page:
1 – 2 of 2