rs7041225 chr9:131531263 C>T
- Sequence
cccagcgccgaggtcggaggcaac[C/T]ggagcgatcacttccgggaggcgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma) foreskin keratinocyte BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- ZN143_HUMAN CTCF_HUMAN TYY1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | -0.98 | 1.04 | 1.40 | n/a | No Hit | |||
| CTCF_HUMAN | -0.03 | 1.61 | 1.45 | n/a | No Hit | |||
| TYY1_HUMAN | -4.79 | 2.81 | 1.50 | n/a | No Hit | |||
| GCR_HUMAN | 0.10 | 1.32 | 1.00 | n/a | No Hit | |||
| SMCA5_HUMAN | -0.58 | 3.00 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid