rs7071593 chr10:77587249 C>T
- Sequence
catcatctctgcttggaaactcta[C/T]accaagattgcaccatcacgccct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MSC (mesenchymal stem cells)
- ASB for transcription factors
- SIX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SIX4_HUMAN | 2.76 | -2.64 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1