rs7087559 chr10:107918461 A>T
- Sequence
gggcatgccccatcgcatcagtga[A/T]aacaacggcacaattggtcagaat
- ASB in cell types
- Kelly (neuroblastoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.75 | 1.87 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1