rs7098517 chr10:86584222 C>T
- Sequence
gtgatgggtgtgcgagcaacggtc[C/T]ggccaaccctttgctcatctcctg
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.25 | n/a | 2.67 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), maternal transmission distortion, partial epilepsy, paternal transmission distortion, stabilized warfarin dose, transmission distortion