rs710609 chr3:190225321 C>T
- Sequence
tctttccaccaatagatggagcca[C/T]atgaacccaattttaaaataattt
- ASB in cell types
- hASC (preadipocytes) TTC-1240 (Rhabdoid tumor of the kidney) tibial nerve PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hASC (preadipocytes) | 1.93 | n/a | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.49 | -2.03 | 1.00 | |||
| tibial nerve | 2.35 | -1.83 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.12 | -0.27 | 1.00 |
Items per page:
1 – 4 of 4