rs7116106 chr11:120685309 G>T
- Sequence
aaaatctccagtcctatcccagag[G/T]tactaaatcagtgtctgcattttc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) stomach
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.27 | 1.72 | 1.00 | |||
| stomach | n/a | 2.40 | 1.00 |
Items per page:
1 – 2 of 2