rs7118697 chr11:72431026 T>C
- Sequence
atgtcaaggagatgaaatgacagt[T/C]gagacgtctgcaaactccccagtg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 0.54 | -0.53 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.66 | 0.51 | 1.33 |
Items per page:
1 – 2 of 2