rs71320541 chr21:42672162 G>C
- Sequence
tgcaatcagaaatatcagtaattt[G/C]agaacaaggcaaacagagctgcac
- ASB in cell types
- primary prostate cancer LNCaP95
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary prostate cancer | 3.32 | n/a | 2.00 | |||
| LNCaP95 | 0.02 | 0.95 | 2.00 |
Items per page:
1 – 2 of 2