rs7133323 chr12:4307961 A>C
- Sequence
aatgactgtccgcatggtttcaac[A/C]tgcagttcttcctgcgaagtccac
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma) pancreas HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 2.03 | -1.20 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 1.02 | -1.75 | 1.33 | |||
| pancreas | 1.01 | -1.01 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.41 | -0.13 | 1.00 | |||
| erythroid cells | -1.96 | 2.28 | 1.50 |
Items per page:
1 – 5 of 6