rs7137207 chr12:98399636 G>A
- Sequence
ttgtcttttcacaaagtccacccc[G/A]cagaagccaaaggcttgccttcaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.71 | 0.28 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, fasting insulin, hdl cholesterol, microalbuminuria, pagets disease of bone, rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp)