rs7138722 chr12:52152096 T>C
- Sequence
tctggctgtgtctagttccaagac[T/C]ccccgccgcaccttgggcactggc
- ASB in cell types
- LUHMES (lund human mesencephalic cells) GM12878 (female B-cells lymphoblastoid cell line) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 3.01 | -0.90 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.58 | -0.25 | 1.00 | |||
| HCT-116 (colon carcinoma) | 0.67 | 0.17 | 1.02 |
Items per page:
1 – 3 of 3