rs71418493 chr2:58448140 C>G
- Sequence
cctgcctccagcctactgctatca[C/G]ttttgtcttccccacagctattgg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) GSC23 (Glioblastoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.50 | 2.70 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1