rs71486879 chr11:18775865 C>A
- Sequence
gagggtggaacggcagtgaaccag[C/A]agagggcgctcacagcatcaggga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) FB8470 (fibroblasts)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | -0.27 | 1.42 | -2.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
