rs7151975 chr14:70087174 T>C
- Sequence
aaaaataattcagaatctttctta[T/C]ctccagatgtccttgtcaaagtcc
- ASB in cell types
- foreskin keratinocyte neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.05 | -2.41 | 2.00 | |||
| neural cell | -0.01 | 1.02 | 1.00 |
Items per page:
1 – 2 of 2