rs7153726 chr14:71323149 C>G
- Sequence
attttggtatagtgcccccatctt[C/G]attgtttaggaacttttaaaaaac
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) H929 (plasma cell myeloma) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.23 | 1.24 | 1.30 | 2.18 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
