rs7161311 chr14:24806348 T>G
- Sequence
agctggatttcacagcagggcagg[T/G]gaacctaggtcttcatcctaaata
- ASB in cell types
- MS-1 (Small cell lung carcinoma) RH4 (alveolar rhabdomyosarcoma) A549 (lung carcinoma) FT282 (normal human fallopian tube tissue)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.75 | 1.10 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, nicotine dependence (smoking), premature ovarian failure, rheumatoid arthritis, schizophrenia, tetrology of fallot, triglycerides