rs71627068 chr5:74685135 C>T
- Sequence
ggggcctggaggcggagtcggggg[C/T]gggcgcgcgcagtcatctgactcg
- ASB in cell types
- K562 (myelogenous leukemia) BJ1-hTERT (Human fibroblast telomerase immortalized cell line)
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | 1.44 | -0.73 | 1.50 | -0.80 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood