rs7176565 chr15:65706364 T>C
- Sequence
aaagaagagtgagcaagttctcta[T/C]gagtgccaaaataattaagtgaaa
- ASB in cell types
- germinal center B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 1.70 | 0.24 | 2.40 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, body mass index (bmi), college completion, hdl cholesterol, height, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), microalbuminuria, p wave duration, prop taste detection threshold, years of education
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Testis, Thyroid, Whole_Blood