rs7197049 chr16:85001368 A>G
- Sequence
acctgtaatcctagctacttgggc[A/G]gctgaggcaggaaaatcacttgaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC2_HUMAN | 2.52 | -0.14 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Thyroid, Whole_Blood